ID: 1162905848_1162905860

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1162905848 1162905860
Species Human (GRCh38) Human (GRCh38)
Location 19:13823445-13823467 19:13823488-13823510
Sequence CCACCTGGAGACCCGCCAGTGTG ACGGCCGCCAAGGGTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120} {0: 1, 1: 0, 2: 0, 3: 20, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!