ID: 1162907332_1162907354

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1162907332 1162907354
Species Human (GRCh38) Human (GRCh38)
Location 19:13831579-13831601 19:13831627-13831649
Sequence CCTCATACCTCACCCCCTTATCC TGGGCACTAGGGTCCCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 287} {0: 1, 1: 0, 2: 2, 3: 17, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!