ID: 1162907843_1162907855

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162907843 1162907855
Species Human (GRCh38) Human (GRCh38)
Location 19:13833974-13833996 19:13834025-13834047
Sequence CCACGAATGTTCCCATGTTCCTG AAATGTCCCCCCTTAAGAACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!