ID: 1162924460_1162924470

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1162924460 1162924470
Species Human (GRCh38) Human (GRCh38)
Location 19:13923307-13923329 19:13923335-13923357
Sequence CCCGCCACCAGCCTCGTCCTCCC GCCGCCTGCCCCTGTCAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 314, 4: 2820} {0: 1, 1: 0, 2: 1, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!