ID: 1162924464_1162924476

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1162924464 1162924476
Species Human (GRCh38) Human (GRCh38)
Location 19:13923314-13923336 19:13923350-13923372
Sequence CCAGCCTCGTCCTCCCCAGGTGC CAACAAGGACGACTTTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 28, 2: 2792, 3: 96349, 4: 251169} {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!