ID: 1162926987_1162926992

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1162926987 1162926992
Species Human (GRCh38) Human (GRCh38)
Location 19:13935761-13935783 19:13935782-13935804
Sequence CCATCACTTGGTTGGCAGCCAGA GATCCGCGACACGGAGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!