ID: 1162932039_1162932048

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1162932039 1162932048
Species Human (GRCh38) Human (GRCh38)
Location 19:13962258-13962280 19:13962275-13962297
Sequence CCTGCGCCGGCCCGGGGCTCAGG CTCAGGGCTGGGCCCAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 42, 4: 402} {0: 1, 1: 1, 2: 8, 3: 81, 4: 663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!