ID: 1162945323_1162945328

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1162945323 1162945328
Species Human (GRCh38) Human (GRCh38)
Location 19:14039807-14039829 19:14039822-14039844
Sequence CCCTGGAGGCCACTGTCCATTGG TCCATTGGGCCCCACCTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 170} {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!