ID: 1162947847_1162947859

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1162947847 1162947859
Species Human (GRCh38) Human (GRCh38)
Location 19:14054539-14054561 19:14054586-14054608
Sequence CCTTCCAACCCCTCCACCAGCAG CACTCTCTCCACCCAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 553} {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!