ID: 1162947852_1162947859

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1162947852 1162947859
Species Human (GRCh38) Human (GRCh38)
Location 19:14054552-14054574 19:14054586-14054608
Sequence CCACCAGCAGCTCCTCCCACTCT CACTCTCTCCACCCAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 75, 4: 684} {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!