ID: 1162953525_1162953535

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1162953525 1162953535
Species Human (GRCh38) Human (GRCh38)
Location 19:14085712-14085734 19:14085743-14085765
Sequence CCTCCGACTGGCCCCTGCCTTGA CCGGAGCCGCGCCGCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 260} {0: 1, 1: 0, 2: 3, 3: 30, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!