ID: 1162955716_1162955724

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1162955716 1162955724
Species Human (GRCh38) Human (GRCh38)
Location 19:14096885-14096907 19:14096902-14096924
Sequence CCACCCCTCATCTGAACCCTCAG CCTCAGAGTTAGGCAAGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 296} {0: 1, 1: 0, 2: 0, 3: 12, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!