ID: 1162966533_1162966544

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1162966533 1162966544
Species Human (GRCh38) Human (GRCh38)
Location 19:14158863-14158885 19:14158905-14158927
Sequence CCCCATCCTCTCTGAGCTGTGAG AACTGTAAGGCTCACCCTTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!