ID: 1162971582_1162971595

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1162971582 1162971595
Species Human (GRCh38) Human (GRCh38)
Location 19:14184002-14184024 19:14184043-14184065
Sequence CCCATGCCCCTGTCCTGACCCTG TCGCATCCTCACCATGAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!