ID: 1162975527_1162975544

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1162975527 1162975544
Species Human (GRCh38) Human (GRCh38)
Location 19:14205738-14205760 19:14205771-14205793
Sequence CCCGCGCCCCGGGCGCTCCGTGG TCCCAGGCCCCTCGCCAGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 20, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!