ID: 1162975651_1162975660

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1162975651 1162975660
Species Human (GRCh38) Human (GRCh38)
Location 19:14206066-14206088 19:14206090-14206112
Sequence CCGGAGCCGGGGCTGGGGGGAAG GGGTAGGAGGTGGCGGGACGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 58, 4: 585} {0: 1, 1: 0, 2: 5, 3: 66, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!