ID: 1162979652_1162979661

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1162979652 1162979661
Species Human (GRCh38) Human (GRCh38)
Location 19:14230397-14230419 19:14230427-14230449
Sequence CCCCCTTCAGAAGGGTCACCCTG CTTTAAGGATAGGCAGACAGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 12, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!