ID: 1163004435_1163004441

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1163004435 1163004441
Species Human (GRCh38) Human (GRCh38)
Location 19:14388744-14388766 19:14388784-14388806
Sequence CCACCGCCTGTCGCTGCAATCCA TGAGATCATCACCACCCCGACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 72} {0: 1, 1: 1, 2: 1, 3: 2, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!