ID: 1163004906_1163004912

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1163004906 1163004912
Species Human (GRCh38) Human (GRCh38)
Location 19:14391091-14391113 19:14391105-14391127
Sequence CCCACGTCCTCTGACTTTCCATC CTTTCCATCCATGAGGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171} {0: 1, 1: 0, 2: 2, 3: 18, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!