ID: 1163012188_1163012194

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1163012188 1163012194
Species Human (GRCh38) Human (GRCh38)
Location 19:14433291-14433313 19:14433309-14433331
Sequence CCGACCTCCGGGGTCACGTGACC TGACCAGGCCCGGCGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!