ID: 1163012188_1163012206

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1163012188 1163012206
Species Human (GRCh38) Human (GRCh38)
Location 19:14433291-14433313 19:14433330-14433352
Sequence CCGACCTCCGGGGTCACGTGACC GGGGCCGGAGGGCGCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 13, 3: 138, 4: 969}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!