ID: 1163012188_1163012209

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1163012188 1163012209
Species Human (GRCh38) Human (GRCh38)
Location 19:14433291-14433313 19:14433337-14433359
Sequence CCGACCTCCGGGGTCACGTGACC GAGGGCGCGGCGCGGGGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 12, 3: 106, 4: 688}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!