ID: 1163012570_1163012574

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1163012570 1163012574
Species Human (GRCh38) Human (GRCh38)
Location 19:14434606-14434628 19:14434633-14434655
Sequence CCGGCCTTGCCGAGGAGCTGGGC CTGGTGTTGCCGATCACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 261} {0: 1, 1: 0, 2: 1, 3: 9, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!