ID: 1163027083_1163027093

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163027083 1163027093
Species Human (GRCh38) Human (GRCh38)
Location 19:14518588-14518610 19:14518614-14518636
Sequence CCGCTCCGCCCTCGGCAACACCT CGCGGCGCGCGCGCACAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197} {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!