ID: 1163038103_1163038114

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1163038103 1163038114
Species Human (GRCh38) Human (GRCh38)
Location 19:14583293-14583315 19:14583343-14583365
Sequence CCAGGGCTTGAGGGATGGAGGGA CTTTCCCCTGGAAGGGACCATGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 7, 3: 57, 4: 558} {0: 3, 1: 0, 2: 2, 3: 17, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!