ID: 1163042108_1163042114

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1163042108 1163042114
Species Human (GRCh38) Human (GRCh38)
Location 19:14610253-14610275 19:14610293-14610315
Sequence CCTGCCCTTTCGTGGACGGCCTT CACACAGATGTGCCTCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 49} {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!