ID: 1163100399_1163100409

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1163100399 1163100409
Species Human (GRCh38) Human (GRCh38)
Location 19:15092357-15092379 19:15092382-15092404
Sequence CCACGGGGAGTGGGACCATGACA GTTTAAGGAGGATAGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 97} {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!