ID: 1163100418_1163100424

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1163100418 1163100424
Species Human (GRCh38) Human (GRCh38)
Location 19:15092478-15092500 19:15092529-15092551
Sequence CCAGGTCGTCAATATTGTCAGCT GACTGAACTCTGCTGCTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124} {0: 1, 1: 0, 2: 1, 3: 11, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!