ID: 1163112587_1163112596

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1163112587 1163112596
Species Human (GRCh38) Human (GRCh38)
Location 19:15170463-15170485 19:15170507-15170529
Sequence CCCAGGACGAGAATGACCAGCAG CAGTGGCAGCAGCGGGACGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123} {0: 1, 1: 0, 2: 1, 3: 47, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!