ID: 1163112588_1163112599

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1163112588 1163112599
Species Human (GRCh38) Human (GRCh38)
Location 19:15170464-15170486 19:15170517-15170539
Sequence CCAGGACGAGAATGACCAGCAGC AGCGGGACGCTGGGTTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112} {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!