ID: 1163146243_1163146244

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1163146243 1163146244
Species Human (GRCh38) Human (GRCh38)
Location 19:15380576-15380598 19:15380596-15380618
Sequence CCATGAGGGAGGACTTCTTGGAC GACTGCTCCATCATGAGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152} {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!