ID: 1163154172_1163154177

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1163154172 1163154177
Species Human (GRCh38) Human (GRCh38)
Location 19:15431147-15431169 19:15431167-15431189
Sequence CCATGGCCACCATTGCGTTTTCC TCCTCAGAACCCAGGCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 138} {0: 1, 1: 0, 2: 2, 3: 22, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!