ID: 1163158817_1163158820

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1163158817 1163158820
Species Human (GRCh38) Human (GRCh38)
Location 19:15452988-15453010 19:15453017-15453039
Sequence CCTGGGGTCACACAGCACAGCGA TACTTGAACCCAGACTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 296} {0: 1, 1: 0, 2: 1, 3: 19, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!