ID: 1163168534_1163168540

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1163168534 1163168540
Species Human (GRCh38) Human (GRCh38)
Location 19:15514555-15514577 19:15514593-15514615
Sequence CCAGCTACTCGGGAGGCTGAGGC CCTGGGAGGCAGAAGTTGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!