ID: 1163174857_1163174864

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1163174857 1163174864
Species Human (GRCh38) Human (GRCh38)
Location 19:15557128-15557150 19:15557149-15557171
Sequence CCTTCCCCATCCCTCTTCTCCAT ATTGCCCTAATTGTGTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 275, 4: 2116} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!