ID: 1163241606_1163241619

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163241606 1163241619
Species Human (GRCh38) Human (GRCh38)
Location 19:16067244-16067266 19:16067270-16067292
Sequence CCCAGAGCAGCCCCCACCCTAGG TGCCCGGGACACGCCCACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 324} {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!