ID: 1163256717_1163256724

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1163256717 1163256724
Species Human (GRCh38) Human (GRCh38)
Location 19:16160504-16160526 19:16160547-16160569
Sequence CCAAATGCTGGGGTTACAGGCTT GTAGCTGCTTAATTTATTAGCGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 554, 3: 3280, 4: 5069} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!