ID: 1163258645_1163258655

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1163258645 1163258655
Species Human (GRCh38) Human (GRCh38)
Location 19:16173260-16173282 19:16173304-16173326
Sequence CCCTCCACCCCACACTCACACAG CAGAGCAGAACCAGGAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 199, 4: 1675} {0: 1, 1: 0, 2: 2, 3: 53, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!