ID: 1163260321_1163260333

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1163260321 1163260333
Species Human (GRCh38) Human (GRCh38)
Location 19:16185725-16185747 19:16185768-16185790
Sequence CCCCGGCCCAGGCGGCCTTCGAG GAGCAGAAGCAGAAGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 122} {0: 1, 1: 0, 2: 2, 3: 39, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!