ID: 1163262201_1163262212

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1163262201 1163262212
Species Human (GRCh38) Human (GRCh38)
Location 19:16198086-16198108 19:16198107-16198129
Sequence CCCTCCCTGTTGCCAGGCAACCG CGGCAGGGGCCTCCGCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 162} {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!