ID: 1163280185_1163280187

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1163280185 1163280187
Species Human (GRCh38) Human (GRCh38)
Location 19:16311549-16311571 19:16311602-16311624
Sequence CCTTCAAGTTTCTGCTTAAAAGG CAGAATCTCACTCTGTCACCAGG
Strand - +
Off-target summary No data {0: 53, 1: 1102, 2: 3599, 3: 8325, 4: 12779}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!