ID: 1163314961_1163314971

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1163314961 1163314971
Species Human (GRCh38) Human (GRCh38)
Location 19:16535520-16535542 19:16535540-16535562
Sequence CCATGGATGGCGCGCCCTGGGCC GCCGGCGGGATGGGCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168} {0: 1, 1: 0, 2: 6, 3: 54, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!