ID: 1163321226_1163321238

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1163321226 1163321238
Species Human (GRCh38) Human (GRCh38)
Location 19:16576194-16576216 19:16576246-16576268
Sequence CCCGGGTCAGACCAGGGAGGTCC CAGCTGCCTGGCCCCTTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221} {0: 1, 1: 2, 2: 5, 3: 130, 4: 4058}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!