ID: 1163340369_1163340378

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1163340369 1163340378
Species Human (GRCh38) Human (GRCh38)
Location 19:16702459-16702481 19:16702487-16702509
Sequence CCGGTGGCTCCCAAAGTCCTGTA AGCACTTTGGGAGGCCTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 1971} {0: 2128, 1: 148322, 2: 179901, 3: 114523, 4: 58215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!