ID: 1163365079_1163365092

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1163365079 1163365092
Species Human (GRCh38) Human (GRCh38)
Location 19:16871349-16871371 19:16871401-16871423
Sequence CCTACGTGGGCTTCACCATGGAC GAGCCGGGCCGGGGTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97} {0: 2, 1: 2, 2: 25, 3: 253, 4: 1937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!