ID: 1163365081_1163365092

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1163365081 1163365092
Species Human (GRCh38) Human (GRCh38)
Location 19:16871364-16871386 19:16871401-16871423
Sequence CCATGGACAAGCTGGTGCAGAAC GAGCCGGGCCGGGGTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148} {0: 2, 1: 2, 2: 25, 3: 253, 4: 1937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!