ID: 1163390095_1163390104

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1163390095 1163390104
Species Human (GRCh38) Human (GRCh38)
Location 19:17025675-17025697 19:17025710-17025732
Sequence CCCCCCAGGGCTGAGAACCACTA CCAGCTTTGAAAGAAGCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 125, 4: 484} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!