ID: 1163404342_1163404345

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1163404342 1163404345
Species Human (GRCh38) Human (GRCh38)
Location 19:17113021-17113043 19:17113041-17113063
Sequence CCCATGTCACGAGGAGCAAAGGG GGGAAGCCAGCATTTGTTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!