ID: 1163427140_1163427151

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1163427140 1163427151
Species Human (GRCh38) Human (GRCh38)
Location 19:17245888-17245910 19:17245926-17245948
Sequence CCCGCGCGCCGGCCTCGCGCTGC CAGCGTTCCATTCGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 264} {0: 1, 1: 0, 2: 1, 3: 1, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!