ID: 1163430455_1163430479

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1163430455 1163430479
Species Human (GRCh38) Human (GRCh38)
Location 19:17264162-17264184 19:17264213-17264235
Sequence CCCCGGGGCCCTGCTCTGAGCCA ATCTGGGTGTGGAGGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 374} {0: 1, 1: 0, 2: 6, 3: 88, 4: 879}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!